Back to top

Primer-Probe Sets for the Detection of SARS-CoV-2

Primer-Probe Sets for the Detection of  SARS-CoV-2
 
 
To help speed up the work of researchers working on the new coronavirus, Microsynth is now providing ready-to-use primers and probes for detection and identification of SARS-CoV-2. These ready-to-use primers and probes will be made available to ship immediately, with quick re-supply whenever necessary. We aim to prioritize all Coronavirus (SARS-CoV-2) related projects for as long as it is needed.
 
Research Use Only. Not for Use in Diagnostic Procedures.
 

Features and Benefits

 
 
Fast Shipping
  • Same-day shipment if you order until 12 noon, otherwise next business day
  • Per express mail free of charge
 
High Quality
  • Manufacture in an ISO 13485:2016 certified production facility
  • Stringent QC including qPCR functionality testing (positive and no template control with Cp <40) prior to batch release
  • Oligos are shipped from a “clean” facility since we do not synthesize positive controls
 
 
 
Convenient
  • Primers-probe sets for 1’000 reactions (with ready-to-use working concentration according to Charité/Berlin Protocol)
  • Covering most common qPCR instruments (incl. cobas®6800/8800 systems from Roche)
 
Recommended by WHO
  • Primer and probe sequences with same dye technologies as recommended by WHO
  • Full transparency regarding sequence information
 

Products

 
E_Sarbeco Primer-Probe Set
Article Number: 1600
Name of Primers & Probes Sequences Modification Yield (nmol)1 Physical Condition Price [CHF/EUR]
E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGT   30 liquid 500.- / 450.-
E_Sarbeco_R2 ATATTGCAGCAGTACGCACACA   30
E_Sarbeco_P1 ACACTAGCCATCCTTACTGCGCTTCG 5'6-FAM, 3'BHQ1 10
 
Product Information:
 
 
E_Sarbeco Primer-Probe Set cobas®
Article Number: 1610
Name of Primers & Probes Sequences Modification Yield (nmol)1 Physical Condition Price [CHF/EUR]
E_Sarbeco_F1 AACAGGTACGT TA ATAGT TA ATAGCmGT   90 liquid 950.- / 860.-
E_Sarbeco_R2 ATATTGCAGCAGTACGCACAmCA   90
E_Sarbeco_P1 ACACTAGCC/iQ500/ATCCTTACTGCGCTTCG 5'6-FAM, 3'BHQ1 15
 
Product Information:
 
RdRP_SARS Primer-Probe Set
Article Number: 1620
Name of Primers & Probes Sequences Modification Yield (nmol)1 Physical Condition Price [CHF/EUR]
RdRP_SARSr-F2 GTGARATGGTCATGTGTGGCGG   30 liquid 700.- / 640.-
RdRP_SARSr-R1 CARATGTTAAASACACTATTAGCATA   30
SARSr-P2 CAGGTGGAACCTCATCAGGAGATGC 5'6-FAM, 3'BHQ1 10
SARSr-P1 CCAGGTGGWACRTCATCMGGTGATGC 5'6-FAM, 3'BHQ1 10
 
Product Information:
 
 
1 Suitable for minimally 1’000 PCR reactions (25 µl volume) 

How to Order

 
 
Place your order by writing an email to info@microsynth.ch and specifying following items:
  • Desired article number
  • Required number of primer-probe sets
  • Your delivery and invoice address
 
Important remark:
We do currently not accept orders for synthetic oligonucleotide positive controls related to any SARS coronavirus sequence.
In case you need a positive control, we kindly ask you to approach following source: https://www.european-virus-archive.com/