Hints & Tips
- Premium vs. Economy Run Service
- DNA Template Preparation
- Shipment of Samples
- Sequencing Primers
- Standard Primer List
- Sample Amounts & Concentrations
- Chromatogram Evaluation
| Premium vs. Economy Run |
>>to the top |
The following table provides an overview of the main differences between our Premium Run Service and our (Barcode) Economy Run Service:
|
Service Features |
Premium Run |
Economy Run & Barcode Economy Run |
|
Sample preparation via the customer |
DNA sample and sequencing primer are to be kept separate |
DNA sample and sequencing primer can be mixed or kept separate |
|
Sample amount requirements |
Is variable and depends on the number of anticipated sequencing reactions |
Is fixed; a pre-defined sample amount will be required per sequencing reaction |
|
Addition of sequencing primers at Microsynth |
Standard or specific sequencing primers are added free of charge |
Standard or specific sequencing primers can be added free of charge |
|
Time schedule |
1 day per reaction |
1 day per reaction |
|
Sequence read length per run |
Up to 1‘100 bases (~800 on average) |
Up to 1‘100 bases (~800 on average) |
|
Editing |
Your choice |
Not available |
|
Paper printout of chromatograms |
Your choice |
Not available |
|
Customer support |
Intensive |
Basic |
|
Troubleshooting |
Yes, full support including problem-oriented solutions |
No |
|
Repetition of failed reactions |
Yes |
Upon request |
|
Combination with additional useful services |
Yes Can be combined with following services:
|
Limited
|
|
Storage of samples |
Yes Templates: 3 months Primers: 1 year |
No |
| DNA Template Preparation |
>>to the top |
First of all, in order to yield good sequencing results it is critical that your DNA template does not contain EDTA. EDTA inhibits the polymerase and hence precludes proper amplification of your DNA template (chain-termination method). Therefore, we highly recommend that you re-suspend your samples either in water or in 10 mM Tris buffer (pH 8.5).
Second, we kindly suggest you to read and consider the following points with respect to isolation/preparation of your DNA templates from E. coli cultures or after performing PCR amplification.
Plasmids
It is generally known that some plasmids have a low copy number in E. coli. If you have to deal with such low copy plasmids, please purify them ahead of sequencing (e.g. by means of ethanol precipitations or by applying spin columns). If you feel unsafe or if you don’t want to deal with such additional work, please let us know and instruct us to do this for you.
Please Note: Precipitation with ethanol after DNA isolation can improve the quality of your sequencing results!
In order to obtain reliable sequencing results, impurities such as dNTPs, PCR primers etc. must be eliminated from the PCR product before sequencing. Furthermore, it is important to quantify the purified PCR product. This is easily accomplished by performing agarose gel electrophoresis of your PCR product and comparing the band for your PCR product with standard bands of defined concentrations. We do not recommend quantification approaches based on spectrophotometric analysis techniques. For successful sequencing, PCR products must be single-banded on the agarose gel. If this is not the case, the sequencing output is likely to be useless. Therefore, purification through agarose gel is important.
Please Note: If available, please send a picture of the gel image after the final purification step.Please check that your PCR primers meet the requirements for sequencing primers. Sometimes usage of internal sequencing primers is helpful.PCR products <100 bases are often problematic for sequencing. Instead of sequencing such PCR products directly, we recommend cloning them into a plasmid vector.
| Shipment of Samples |
>>to the top |
First of all, when shipping samples for sequencing to Microsynth, please make sure your order form (printout) accompanies your sequencing samples.
Second, we kindly suggest reading and considering the following points with respect to use of tubes, its labeling and packaging as well as its shipment conditions
Tubes
Our process of sequencing has been continuously optimized over the previous 18 years. And we’ve determined that our highly automated sequencing process is especially robust and successful, if we use 1.5 ml Sarstedt screw cap tubes (Product No: 72.692.005). Furthermore, these tubes are extremely stable. The risk of tube breakage during shipment is almost nil. For this reason, we have decided to accept this kind of tube only. These tubes can be easily ordered at one of the following phone numbers:
- Switzerland: Phone + 41 81 750 1880
- Germany: Phone +49 2293 305 0
- Austria: Phone +43 2236 61682
Should you not have them available in your lab and/or encounter any problems when ordering them from your local supplier for disposables, please give us a call and we will forward you a batch of Sarstedt tubes free of charge.
Please note that these Sarstedt tubes have a tight seal and are quite stable. Wrapping the tubes in parafilm is not necessary.
Labeling
Barcode Economy Run: Just stick the green, pre-paid barcode label on the tube
Economy Run: We provide you blue barcode labels (not pre-paid!) which can be stuck on the tube for sample identification. Alternatively, tubes with handwritten labels are fine, but please write clearly and use a waterproof pen. Write on the tube, not on the lid.
Premium Run: Tubes with handwritten labels are fine (please write clearly and use a waterproof pen). Write on the tube, not on the lid.
Shipping Conditions
Purified DNA templates
| Country | Address |
Shipping Conditions of DNA Samples and Primers | Comment |
| Switzerland |
Microsynth AG Schützenstrasse 15 P.O. Box CH-9436 Balgach |
liquid at room temperature | It is important that you mark “A-Priority” on the padded envelopes. |
| Germany |
Microsynth AG Germany |
liquid at room temperature | Samples carried by a courier service must be sent to our Swiss address. In such case do not use the address of the P.O. box. |
| Austria |
Microsynth AG Austria |
liquid at room temperature |
|
| Other countries |
Microsynth AG Switzerland |
dried at room temperature |
E. coli
E. coli must be provided as visible, single colonies on agar plates. The agar needs to be firm enough not to slide to the lid during transport. E. coli arriving before noon are amplified overnight and sequenced the next business day. DNA quality also depends on the strain used for plasmid amplification. Best DNA quality is achieved when endA- E. coli strains are used (e. g. XL1-Blue, DH5a, DH1, C600 SURE, HB101). Some strains are known to yield lower DNA quality and yields compared with the endA- E. coli strains. Strains like JM83, JM101, NM522, NM544, TB1, TG1, BL21, MC1061, or Y1088 are known to be a bit more problematic and could result in suboptimal sequencing results.
| Sequencing Primers | >>to the top |
With respect to the use of standard or specific sequencing primers we can offer you the following four options:
- You select and use one of our standard primers free of charge
- You have your own sequencing primer and want to use it. All you have to do is send the primer along with your samples.
- You want to order a specific sequencing primer but don’t know how to design it. In this case, please provide all essential information and we will do the design and subsequent synthesis.
- You want to order a specific sequencing primer. Just follow the design guidelines further below and initiate a purchase order via our webshop. Just use the “order now” option.
- Primer length should be ~20 bases (+/-2)
- G/C content should be ~50 %
- Avoid hairpins, palindromic sequence and dimers
- Avoid primers with 90 % assembly with a second binding site or where the last 7 bases from the primer's 3'-end match perfectly with another site
- Please remember that 30-60 nucleotides get lost between the 3'-end of the primer and the start of sequence. Take this into account when you choose your primer position
Primer Storage
All primers used for our Premium Run Service will be stored at our facility for 1 year. During this time these primers or aliquots of them will be sent to you only upon request. After one year they will be discarded without further notice.
| Standard Primer List | >>to the top |
| Primer Name |
Primer Sequence |
| 3-AOX1 | GCAAATGGCATTCTGACATCC |
|
3xFlag-for |
GATATCGGTACCAGTCTC |
|
5-AOX1 |
GACTGGTTCCAATTGACAAGC |
|
-96glll |
CCTCATAGTTAGCGTAAC |
|
AmpStart |
AAAACAGGAAGGCAAAATGC |
|
AmpStop |
TCAGGCAACTATGGATGAAC |
|
BAC2 |
GTCACGACGTTGTAAAACG |
|
BGH-rev |
TAGAAGGCACAGTCGAGG |
|
CEP4-for |
AGCTCGTTTAGTGAACCG |
| C-CMV-24 | TAGGACAAGGCTGGTGGGCAC |
|
CMV-for |
CGCAAATGGGCGGTAGGCGTG |
|
CMV-rev |
AGTAGGAAAGTCCCGTAAGG |
|
EBV-rev |
GTGGTTTGTCCAAACTCATC |
|
EGFP-C |
GTCCTGCTGGAGTTCGTG |
|
EGFP-C1-anti |
GGTTCAGGGGGAGGTGTG |
|
EGFP-N |
GCTTGCCGTAGGTGGCATC |
|
ER-8 |
GGCCCGGCATTCTCGCACGC |
|
ESP3-for |
AAGGAAGAGGAATCCTGGC |
|
ESP3-rev |
AACCTAGTATAGGGGATCTC |
|
FastBac-for |
TACTGTTTTCGTAACAGTTTTG |
|
FastBac-rev |
CATTTTATGTTTCAGGTTCAGG |
|
Gal4 |
TCATCGGAAGAGAGTAG |
|
Gal4-AD |
TACCACTACAATGGATG |
|
Gex3-rev |
GCTTACAGACAAGCTGTGAC |
|
Gex5-for |
CCAGCAAGTATATAGCATGG |
|
GL3 |
CCGGGCCTTTCTTTATGTTTTTG |
|
GLprimer2 |
CTTTATGTTTTTGGCGTCTTCC |
|
IRES-for |
TAGGCGTGTACGGTGGG |
|
IRES-rev |
TATAGACAAACGCACACCG |
|
ITS1 |
TCCGTAGGTGAACCTGCGG |
|
ITS4 |
TCCTCCGCTTATTGATATGC |
|
KanaOligo |
ATGCGCCAGAGTTGTTTCTG |
|
LacOp-for |
CGGATAACAATTTCACACAG |
|
M13 |
TGTAAAACGACGGCCAG |
|
M13-40 |
GTTTTCCCAGTCACGAC |
|
M13r |
CAGGAAACAGCTATGACC |
| M13r-short | CAGGAAACAGCTATGAC |
|
malE |
GGTCGTCAGACTGTCGATG |
| N-CMV-32 | GTAATAACCCCGCCCCGTTGAC |
|
pBAD-for |
ATGCCATAGCATTTTTATCC |
|
pBAD-rev |
GATTTAATCTGTATCAGG |
|
pcDNA1.1-rev |
GGTTCCTTCACAAAGATCC |
|
pcEGFP |
CAACGAGAAGCGCGATC |
|
pCIneo-for |
CCACTCCCAGTTCAATTACAG |
|
pCIneo-rev |
GTATCTTATCATGTCTGCTCG |
|
pCI-rev |
GCAATAGCATCACAAATTTCAC |
|
pCR3.1-rev |
TAGAAGGCACAGTCGAGG |
|
pDONR-3 |
GCAATGTAACATCAGAGAT |
|
pDONR-5 |
TAACGCTAGCATGGATCTC |
|
PEN1-737R |
TCCAGCTCGACCAGGAT |
|
pENTattL1-for |
TCGCGTTAACGCTAGCATGG |
|
pENTattL2-rev |
ACATCAGAGATTTTGAGACACG |
|
pET-up |
ATGCGTCCGGCGTAG |
|
pET-down |
GATTATGCGGCCGTGTAC |
|
pETG-for |
CTGGCAAGCCACGTTTGG |
|
Pet-T7side |
GGGAATTGTGAGCGGATAAC |
|
pGL-for |
GTATCTTATGGTACTGTAACTG |
|
pGMP-rev |
GATATAGTTCCTCCTTTCAGC |
|
pJET1.2-for |
CGACTCACTATAGGGAG |
|
pJET1.2-rev |
ATCGATTTTCCATGGCAG |
|
pJET1-for |
CTGAACACCATATCCATCC |
|
pJET1-rev |
GCAGCTGAGAATATTGTAG |
|
pKK223-3-for |
GGCGTTTCACTTCTGAGTTC |
|
pKK223-3-rev |
CGGTTCTGGCAAATATTCTG |
|
PolyT-A |
TTTTTTTTTTTTTTTTTTTTA |
|
PolyT-C |
TTTTTTTTTTTTTTTTTTTTC |
|
PolyT-G |
TTTTTTTTTTTTTTTTTTTTG |
|
PolyT-V |
TTTTTTTTTTTTTTTTTTTTv |
|
pQE-for |
GTATCACGAGGCCCTTTCG |
|
pQE-rev |
CATTACTGGATCTATCAAC |
|
pSE1a |
TGTGTTACTCATAGCGCGT |
|
pSE2 |
GCTGCTGCAAAACAGATAC |
|
pSec-Tag |
TAGAAGGCACAGTCGAGG |
|
pTrc-His2 |
AGAGGTATATATTAATGTATCG |
|
pTRE2-for |
ACGCTGTTTTGACCTCCATAG |
|
pTRE2-rev |
ATGAATTTTACAATAGCGAA |
|
pUCM13-52 |
GCTGCAAGGCGATTAAGTTG |
|
pUCM13-rev-57 |
TGCTTCCGGCTCGTATGTTG |
|
Puro-rev |
TGTACTCGGTCATGGTAAGC |
|
Qe30-for |
CTTTCGTCTTCACCTCGAG |
|
Qe30-rev |
CCAAGCTAGCTTGGATTCTC |
|
RV3 |
CTAGCAAAATAGGCTGTCC |
|
RVpr-4 |
GACGATAGTCATGCCCCGC |
| SK | CTAGAACTAGTGGATCC |
|
SP6 |
ATTTAGGTGACACTATAG |
|
SUMO-5 |
CCTTAAGATTCTTGTACGACG |
|
SV40-for |
GCCCCTAACTCCGCCCATCC |
|
SV40-pA-rev |
CCTCTACAAATGTGGTATGG |
|
T3 |
TTAACCCTCACTAAAGG |
|
T7 |
TAATACGACTCACTATAGG |
|
T7term |
TGCTAGTTATTGCTCAGCGG |
|
TET-CMV-for |
CCTCCATAGAAGACACC |
|
U6 |
GGGCAGGAAGAGGGCCTAT |
|
WHV-5R |
AGCAGCGTATCCACATAGCG |
|
XL39-rev |
TAGGACAAGGCTGGTGG |
| Sample Amounts & Concentrations | >>to the top |
Premium Run Service
General Information:
Each DNA sample and each primer must have a minimum volume of 20 µl. DNA samples and primers for sequencing reactions are best dissolved in pure water. Alternatively, 10 mM Tris-HCl (pH 8) or 10 mM Tris-HCl (pH 8) with a maximum of 0.01 mM EDTA can be used for better long term DNA stability. Standard TE-buffer is not suitable, because higher EDTA concentrations inhibit sequencing polymerase activity. DNA samples will be stored for 3 months, whereas primers will be kept at Microsynth for 1 year.
In order to speed up your sequencing inquiries, we offer the possibility to order sequencing primers directly in the order form (option "order now"). We are also happy to assist you in primer design. Just send us the sequence context and we design and synthesize the needed sequencing primers for you. Stored primers can be added to a custom primer list. The names of these primers are then available in a pull down menu when you order your next sequencing reaction.
Sample Amounts & Concentrations:
|
DNA Template |
Concentration |
Effective Amount (in 20 µl) |
Each Additional Reaction Requires |
|
Plasmid |
100 ng/µl |
2 µg |
+ 5 µl |
|
PCR (> 5000bp) |
100 ng/µl |
2 µg |
+ 5 µl |
|
PCR (< 5000bp) |
40 ng/µl |
0.8 µg |
+ 5 µl |
|
PCR (< 1000bp) |
20 ng/µl |
0.4 µg |
+ 5 µl |
|
PCR (< 500bp) |
10 ng/µl |
0.2 µg |
+ 5 µl |
|
PCR (< 200bp) |
5 ng/µl |
0.1 µg |
+ 5 µl |
|
Primer |
10 pmol/µl = 10 µM |
200 pmol |
+ 5 µl The minimum amount is 20 µl. If you have sufficient primer amounts, please send us more for future sequencing reactions. |
Economy Run and Barcode Economy Run Service
General Information:
DNA samples and sequencing primers can be sent pre-mixed (within one tube) or separate (different tubes). Each DNA sample must have a volume of 15 µl. Each sequencing primer must have a minimal volume of 20 µl whereas for each additional reaction at least 5 µl have to be added. DNA samples and primers for sequencing reactions are best dissolved in pure water. Alternatively, 10 mM Tris-HCl (pH 8) or 10 mM Tris-HCl (pH 8) with a maximum of 0.01 mM EDTA can be used for a better long term DNA stability. Standard TE-buffer is not suitable, because higher EDTA concentrations inhibit polymerase activity. Templates are stored for 1 week whereas primers will be kept at Microsynth for 1 year.
Sample Amounts & Concentrations
|
DNA Template |
Concentration |
Effective Amount (in 15 µl) |
|
Plasmid |
80 ng/µl |
1.2 µg |
|
PCR |
22.5 ng per 100 bases in a volume of 15 µl |
|
| PCR (200bp) |
3.0 ng/µl |
45 ng |
| PCR (300bp) | 4.5 ng/µl | 67.5 ng |
| PCR (400bp) | 6.0 ng/µl | 90 ng |
| PCR (>400bp) | etc. | etc. |
| Primer (pre-mixed) Primer (separate)1 |
2 pmol/µl 10 pmol/µl = 10 µM |
30 pmol - |
1 direct primer synthesis for sequencing possible.
High-Throughput and Barcode High-Throughput Sequencing Service
General Information
Please send the DNA in 96-well plates (at least 10 µl volume). DNA samples and primers for sequencing reactions are best dissolved in pure water. Alternatively, 10 mM Tris-HCl (pH 8) or 10 mM Tris-HCl (pH 8) with a maximum of 0.01 mM EDTA can be used for a better long term DNA stability. Standard TE-buffer is not suitable, because higher EDTA concentrations inhibit sequencing polymerase activity. DNA samples will be stored for 3 months whereas primers will be kept at Microsynth for 1 year.
In order to speed up your sequencing inquiries, we offer the possibility to order sequencing primers directly at Microsynth. Just order the primer in the oligonucleotide order and choose the option “keep primer for sequencing” and leave a comment when you order the sequencing reactions. We are also happy to assist you in primer design. Just send us the sequence context, and we will design and synthesize the needed sequencing primers for you.
Sample Amounts & Concentrations
|
DNA Template |
Amount/Concentration |
|
Plasmid |
0.8 µg |
|
PCR |
purified PCR product: 15 ng /100 bases unpurified PCR product: 30 ng/100 bases |
|
Primer |
20 pmol premixed (unless you use Microsynth’s standard primers or your stored specific primer). 10 µM primer aliquots for separately sent primers. The minimum amount is 200 µl. If you have sufficient primer amounts, please send us more for future sequencing reactions. New primers can also be ordered through the online order form indicating "order now" as primer source. |
Primer Walking Sequencing Service
General Information
DNA samples must have a minimum volume of 20 µl. Primers [10 µM] must have a minimum volume of 20 µl. DNA samples and primers for sequencing reactions are best dissolved in pure water. Alternatively, 10 mM Tris-HCl (pH 8) or 10 mM Tris-HCl (pH 8) with a maximum of 0.01 mM EDTA can be used for better long-term DNA stability. Standard TE-buffer is not suitable, because higher EDTA concentrations inhibit sequencing polymerase activity. DNA samples will be stored for 3 months whereas primers will be kept at Microsynth for 1 year.
Alternatively, you can send your E. coli strain. DNA is isolated free of charge for all Primer Walking Services on plasmids. The design and synthesis of walking primers is included in the service.
Sample Amounts & Concentrations
|
DNA Template |
Amount/Concentration |
|
Plasmid for Single-Stranded Sequencing |
2 µg of plasmid-DNA for a 1 kb insert and another 1 µg for each additional kb |
|
Plasmid for Double-Stranded Sequencing |
4 µg of plasmid-DNA for a 1 kb insert and another 2 µg for each additional kb |
| Chromatogram Evaluation |
>>to the top |
It is always advisable to check the quality of the chromatogram by eye. Please use one of the Software tools for visualization in our Software and Links area.

