Hints and Tips

In the following you will find hints and tips on the following topics. In case this information does not answer your question(s), do not hesitate to contact us.
Premium vs. Economy Run
>>to the top

The following table provides an overview of the main differences between our Premium Run Service and our (Barcode) Economy Run Service:

Service Features

Premium Run

Economy Run & Barcode Economy Run

Sample preparation via the customer

DNA sample and sequencing primer are to be kept separate

DNA sample and sequencing primer can be mixed or kept separate

Sample amount requirements

Is variable and depends on the number of anticipated sequencing reactions

Is fixed; a pre-defined sample amount will be required per sequencing reaction

Addition of sequencing primers at Microsynth

Standard or specific sequencing primers are added free of charge

Standard or specific sequencing primers can be added free of charge

Time schedule

1 day per reaction

1 day per reaction

Sequence read length per run

Up to 1‘100 bases (~800 on average)

Up to 1‘100 bases (~800 on average)

Editing

Your choice

Not available

Paper printout of chromatograms

Your choice

Not available

Customer support

Intensive

Basic

Troubleshooting

Yes, full support including problem-oriented solutions

No

Repetition of failed reactions

Yes

Upon request

Combination with additional useful services

Yes

Can be combined with following services:

  • Special Treatment
  • One-Drop Sequencing
  • DNA Preparation (E. coli)
  • DNA Purification

Limited
Can be combined with following services:

  • Specific treatment of GC-rich samples
  • PCR Purification

 

Storage of samples

Yes

Templates: 3 months

Primers: 1 year

No

 

 

DNA Template Preparation
>>to the top

First of all, in order to yield good sequencing results it is critical that your DNA template does not contain EDTA. EDTA inhibits the polymerase and hence precludes proper amplification of your DNA template (chain-termination method). Therefore, we highly recommend that you re-suspend your samples either in water or in 10 mM Tris buffer (pH 8.5).

 

Second, we kindly suggest you to read and consider the following points with respect to isolation/preparation of your DNA templates from E. coli cultures or after performing PCR amplification.


Plasmids

It is generally known that some plasmids have a low copy number in E. coli. If you have to deal with such low copy plasmids, please purify them ahead of sequencing (e.g. by means of ethanol precipitations or by applying spin columns). If you feel unsafe or if you don’t want to deal with such additional work, please let us know and instruct us to do this for you.

 

Please Note: Precipitation with ethanol after DNA isolation can improve the quality of your sequencing results!

PCR Products

In order to obtain reliable sequencing results, impurities such as dNTPs, PCR primers etc. must be eliminated from the PCR product before sequencing. Furthermore, it is important to quantify the purified PCR product. This is easily accomplished by performing agarose gel electrophoresis of your PCR product and comparing the band for your PCR product with standard bands of defined concentrations. We do not recommend quantification approaches based on spectrophotometric analysis techniques. For successful sequencing, PCR products must be single-banded on the agarose gel. If this is not the case, the sequencing output is likely to be useless. Therefore, purification through agarose gel is important.


Please Note: If available, please send a picture of the gel image after the final purification step.Please check that your PCR primers meet the requirements for sequencing primers. Sometimes usage of internal sequencing primers is helpful. PCR products <100 bases are often problematic for sequencing. Instead of sequencing such PCR products directly, we recommend cloning them into a plasmid vector.

 


Shipment of Samples
>>to the top

 

First of all, when shipping samples for sequencing to Microsynth, please make sure your order form (printout) accompanies your sequencing samples.

 

Second, we kindly suggest reading and considering the following points with respect to use of tubes, its labeling and packaging as well as its shipment conditions

 

Tubes

Our process of sequencing has been continuously optimized over the previous 18 years. And we’ve determined that our highly automated sequencing process is especially robust and successful, if we use 1.5 ml Sarstedt screw cap tubes (Product No: 72.692.005). Furthermore, these tubes are extremely stable. The risk of tube breakage during shipment is almost nil. For this reason, we have decided to accept this kind of tube only. These tubes can be easily ordered at one of the following phone numbers:

  • Switzerland: Phone + 41 81 750 1880
  • Germany: Phone +49 2293 305 0
  • Austria: Phone +43 2236 61682

Should you not have them available in your lab and/or encounter any problems when ordering them from your local supplier for disposables, please give us a call and we will forward you a batch of Sarstedt tubes free of charge.

 

Please note that these Sarstedt tubes have a tight seal and are quite stable. Wrapping the tubes in parafilm is not necessary.

 

Labeling

Barcode Economy Run: Just stick the green, pre-paid barcode label on the tube

Economy Run: We provide you blue barcode labels (not pre-paid!) which can be stuck on the tube for sample identification. Alternatively, tubes with handwritten labels are fine, but please write clearly and use a waterproof pen. Write on the tube, not on the lid.


Premium Run: Tubes with handwritten labels are fine (please write clearly and use a waterproof pen). Write on the tube, not on the lid.

 

Shipping Conditions

Purified DNA templates

Country Address
Shipping Conditions of DNA Samples and Primers Comment
Switzerland
Microsynth AG
Schützenstrasse 15
P.O. Box
CH-9436 Balgach
liquid at room temperature It is important that you mark “A-Priority” on the padded envelopes.
Germany

Microsynth AG
P.O. Box 3351
D-88131 Lindau

Germany

liquid at room temperature Samples carried by a courier service must be sent to our Swiss address. In such case do not use the address of the P.O. box.
Austria

Microsynth AG
P.O. Box 58
A-6961 Wolfurt

Austria

liquid at room temperature
Other countries

Microsynth AG
Schützenstrasse 15
P.O. Box
CH-9436 Balgach

Switzerland

dried at room temperature  

 

E. coli

E. coli must be provided as visible, single colonies on agar plates. The agar needs to be firm enough not to slide to the lid during transport. E. coli arriving before noon are amplified overnight and sequenced the next business day. DNA quality also depends on the strain used for plasmid amplification. Best DNA quality is achieved when endA- E. coli strains are used (e. g. XL1-Blue, DH5a, DH1, C600 SURE, HB101). Some strains are known to yield lower DNA quality and yields compared with the endA- E. coli strains. Strains like JM83, JM101, NM522, NM544, TB1, TG1, BL21, MC1061, or Y1088 are known to be a bit more problematic and could result in suboptimal sequencing results.

 

 

Sequencing Primers >>to the top

With respect to the use of standard or specific sequencing primers we can offer you the following four options:
  1. You select and use one of our standard primers free of charge
  2. You have your own sequencing primer and want to use it. All you have to do is send the primer along with your samples.
  3. You want to order a specific sequencing primer but don’t know how to design it. In this case, please provide all essential information and we will do the design and subsequent synthesis.
  4. You want to order a specific sequencing primer. Just follow the design guidelines further below and initiate a purchase order via our webshop. Just use the “order now” option.
Guidelines for Primer Design
  • Primer length should be ~20 bases (+/-2)
  • G/C content should be ~50 %
  • Avoid hairpins, palindromic sequence and dimers
  • Avoid primers with 90 % assembly with a second binding site or where the last 7 bases from the primer's 3'-end match perfectly with another site
  • Please remember that 30-60 nucleotides get lost between the 3'-end of the primer and the start of sequence. Take this into account when you choose your primer position

Primer Storage

All primers used for our Premium Run Service will be stored at our facility for 1 year. During this time these primers or aliquots of them will be sent to you only upon request. After one year they will be discarded without further notice.


Standard Primer List >>to the top

 

Primer Name Primer Sequence

3-AOX1

GCAAATGGCATTCTGACATCC

3xFlag-for

GATATCGGTACCAGTCTC

5-AOX1

GACTGGTTCCAATTGACAAGC

-96glll CCTCATAGTTAGCGTAAC

AmpStart

AAAACAGGAAGGCAAAATGC

AmpStop

TCAGGCAACTATGGATGAAC

BGH-rev

TAGAAGGCACAGTCGAGG

C-CMV-24

TAGGACAAGGCTGGTGGGCAC

CEP4-for

AGCTCGTTTAGTGAACCG

CMV-for

CGCAAATGGGCGGTAGGCGTG

CMV-rev

AGTAGGAAAGTCCCGTAAGG

DNABint

ACTGGGACTCCATCGTTTCT

EBV-rev

GTGGTTTGTCCAAACTCATC

EGFP-C1-anti

GGTTCAGGGGGAGGTGTG

EGFP-C-F-31

CAAAGACCCCAACGAGAAG

EGFP-C-for

GTCCTGCTGGAGTTCGTG

EGFP-C-Rev

AGCTGCAATAAACAAGTT

EGFP-for

CAACGAGAAGCGCGATC

EGFP-N-for

CAACGGGACTTTCCAAAATG

EGFP-N-R+33

CGGACACGCTGAACTTGTG

EGFP-N-rev

GCTTGCCGTAGGTGGCATC

ER-8

GGCCCGGCATTCTCGCACGC

FastBac-for

TACTGTTTTCGTAACAGTTTTG

FastBac-rev

CATTTTATGTTTCAGGTTCAGG

GAL4-AD

TACCACTACAATGGATG

GAL4-BD

TCATCGGAAGAGAGTAG

GEX3-rev

GCTTACAGACAAGCTGTGAC

GEX3-rev-25

GAGCTGCATGTGTCAGAGG

GEX5-for

CCAGCAAGTATATAGCATGG

GL1

GTATCTTATGGTACTGTAACTG

GL2

CTTTATGTTTTTGGCGTCTTCC

GL3

CCGGGCCTTTCTTTATGTTTTTG

H15149 GCCCCTCAGAATGATATTTGTCCTCA

IRES-for

TAGGCGTGTACGGTGGG

IRES-R-359

ACCCCAACAGCTGGCCCTCG

IRES-rev

TATAGACAAACGCACACCG

ITS1

TCCGTAGGTGAACCTGCGG

ITS4

TCCTCCGCTTATTGATATGC

LacOp-for

CGGATAACAATTTCACACAG

M13

TGTAAAACGACGGCCAG

M13-40

GTTTTCCCAGTCACGAC

M13r

CAGGAAACAGCTATGAC

malE

GGTCGTCAGACTGTCGATG

N-CMV-32 GTAATAACCCCGCCCCGTTGAC

pBAD-F+50

TTATCGCAACTCTCTACTGT

pBAD-for

ATGCCATAGCATTTTTATCC

pBAD-rev

GATTTAATCTGTATCAGG

pCIneo-for

CCACTCCCAGTTCAATTACAG

pCIneo-rev

GTATCTTATCATGTCTGCTCG

pCI-rev

GCAATAGCATCACAAATTTCAC

pDONR-3

GCAATGTAACATCAGAGAT

pDONR-5

TAACGCTAGCATGGATCTC

PEN1-737R TCCAGCTCGACCAGGAT

pENTattL1-for

TCGCGTTAACGCTAGCATGG

pENTattL2-rev

ACATCAGAGATTTTGAGACACG

pET-down

GATTATGCGGCCGTGTAC

pETG-for

CTGGCAAGCCACGTTTGG

pET-T7side

GGGAATTGTGAGCGGATAAC

pET-up

ATGCGTCCGGCGTAG

pGMP-rev

GATATAGTTCCTCCTTTCAGC

pHEN-rev

AGATCCTCTTCTGAGATG

pJET1.2-for

CGACTCACTATAGGGAG

pJET1.2-rev

ATCGATTTTCCATGGCAG

pJET1-for

CTGAACACCATATCCATCC

pJET1-rev

GCAGCTGAGAATATTGTAG

pKK223-3-for

GGCGTTTCACTTCTGAGTTC

pKK223-3-rev

CGGTTCTGGCAAATATTCTG

PolyT-A

TTTTTTTTTTTTTTTTTTTTA

PolyT-V

TTTTTTTTTTTTTTTTTTTTV

pTrc-His2

AGAGGTATATATTAATGTATCG

pTRE-for

TAAGCAGAGCTCGTTTAGTG

pUCM13-52

GCTGCAAGGCGATTAAGTTG

pUCM13-rev-157

TGCTTCCGGCTCGTATGTTG

Puro-rev

TGTACTCGGTCATGGTAAGC

Qe30-for

CTTTCGTCTTCACCTCGAG

Qe30-rev

CCAAGCTAGCTTGGATTCTC

QE-for

GTATCACGAGGCCCTTTCG

QE-rev

GTTCTGAGGTCATTACTGG

RV3

CTAGCAAAATAGGCTGTCC

RV4

GACGATAGTCATGCCCCGC

SK

CTAGAACTAGTGGATCC

SP6

ATTTAGGTGACACTATAG

SUMO-5

CCTTAAGATTCTTGTACGACG

SV40-for

GCCCCTAACTCCGCCCATCC

SV40-pA-rev

CCTCTACAAATGTGGTATGG

T3

TTAACCCTCACTAAAGG

T7

TAATACGACTCACTATAGG

T7probis

TCCCGCGAAATTAATACG

T7terbis

AACCCCTCAAGACCCG

T7term

TGCTAGTTATTGCTCAGCGG

TET-CMV-for

CCTCCATAGAAGACACC

U6

GGGCAGGAAGAGGGCCTAT

WHV-5R

AGCAGCGTATCCACATAGCG

XL39-rev TAGGACAAGGCTGGTGG


Sample Amounts & Concentrations >>to the top

Premium Run Service

General Information:

Each DNA sample and each primer must have a minimum volume of 20 µl. DNA samples and primers for sequencing reactions are best dissolved in pure water. Alternatively, 10 mM Tris-HCl (pH 8) or 10 mM Tris-HCl (pH 8) with a maximum of 0.01 mM EDTA can be used for better long term DNA stability. Standard TE-buffer is not suitable, because higher EDTA concentrations inhibit sequencing polymerase activity. DNA samples will be stored for 3 months, whereas primers will be kept at Microsynth for 1 year.

 

In order to speed up your sequencing inquiries, we offer the possibility to order sequencing primers directly in the order form (option "order now"). We are also happy to assist you in primer design. Just send us the sequence context and we design and synthesize the needed sequencing primers for you. Stored primers can be added to a custom primer list. The names of these primers are then available in a pull down menu when you order your next sequencing reaction.

 

Sample Amounts & Concentrations:

DNA Template

Concentration

Effective Amount (in 20 µl)

Each Additional Reaction Requires

Plasmid

100 ng/µl

2 µg

+ 5 µl

PCR (> 5000bp)

100 ng/µl

2 µg

+ 5 µl

PCR (< 5000bp)

40 ng/µl

0.8 µg

+ 5 µl

PCR (< 1000bp)

20 ng/µl

0.4 µg

+ 5 µl

PCR (< 500bp)

10 ng/µl

0.2 µg

+ 5 µl

PCR (< 200bp)

5 ng/µl

0.1 µg

+ 5 µl

Primer

10 pmol/µl = 10 µM

200 pmol

+ 5 µl

The minimum amount is 20 µl. If you have sufficient primer amounts, please send us more for future sequencing reactions.

 

Economy Run and Barcode Economy Run Service

General Information:

DNA samples and sequencing primers can be sent pre-mixed (within one tube) or separate (different tubes). Each DNA sample must have a volume of 12 µl. Each sequencing primer must have a minimal volume of 20 µl whereas for each additional reaction at least 5 µl have to be added. DNA samples and primers for sequencing reactions are best dissolved in pure water. Alternatively, 10 mM Tris-HCl (pH 8) or 10 mM Tris-HCl (pH 8) with a maximum of 0.01 mM EDTA can be used for a better long term DNA stability. Standard TE-buffer is not suitable, because higher EDTA concentrations inhibit polymerase activity. Templates are stored for 1 week whereas primers will be kept at Microsynth for 1 year.

 

Sample Amounts & Concentrations

DNA Template

Concentration

Effective Amount (in 12 µl) Pipetting Scheme for Pre-mixed Option

Plasmid

60-100 ng/µl1

720-1200 ng 12 µl DNA template solution + 3 µl sequencing primer solution

PCR

18 ng per 100 bases in a volume of 12 µl

PCR (200bp)

3.0 ng/µl

36 ng
PCR (300bp) 4.5 ng/µl 54 ng
PCR (400bp) 6.0 ng/µl 72 ng
PCR (>400bp) etc. etc.
Primer (pre-mixed)
Primer (separate)2
2 pmol/µl
10 pmol/µl = 10 µM
30 pmol
-

 

High-Throughput and Barcode High-Throughput Sequencing Service

General Information

Please send the DNA in 96-well plates (at least 10 µl volume). DNA samples and primers for sequencing reactions are best dissolved in pure water. Alternatively, 10 mM Tris-HCl (pH 8) or 10 mM Tris-HCl (pH 8) with a maximum of 0.01 mM EDTA can be used for a better long term DNA stability. Standard TE-buffer is not suitable, because higher EDTA concentrations inhibit sequencing polymerase activity. DNA samples will be stored for 3 months whereas primers will be kept at Microsynth for 1 year.

 

In order to speed up your sequencing inquiries, we offer the possibility to order sequencing primers directly at Microsynth. Just order the primer in the oligonucleotide order and choose the option “keep primer for sequencing” and leave a comment when you order the sequencing reactions. We are also happy to assist you in primer design. Just send us the sequence context, and we will design and synthesize the needed sequencing primers for you.

 

Sample Amounts & Concentrations

DNA Template

Amount/Concentration

Plasmid

0.8 µg

PCR

purified & unpurified PCR product: 1.5 ng/µl (per 100 bases)

Primer

20 pmol premixed (unless you use Microsynth’s standard primers or your stored specific primer). 10 µM primer aliquots for separately sent primers. The minimum amount is 200 µl. If you have sufficient primer amounts, please send us more for future sequencing reactions. New primers can also be ordered through the online order form indicating "order now" as primer source.

 

Primer Walking Sequencing Service

General Information

DNA samples must have a minimum volume of 20 µl. Primers [10 µM] must have a minimum volume of 20 µl. DNA samples and primers for sequencing reactions are best dissolved in pure water. Alternatively, 10 mM Tris-HCl (pH 8) or 10 mM Tris-HCl (pH 8) with a maximum of 0.01 mM EDTA can be used for better long-term DNA stability. Standard TE-buffer is not suitable, because higher EDTA concentrations inhibit sequencing polymerase activity. DNA samples will be stored for 3 months whereas primers will be kept at Microsynth for 1 year.

 

Alternatively, you can send your E. coli strain. DNA is isolated free of charge for all Primer Walking Services on plasmids. The design and synthesis of walking primers is included in the service.

 

Sample Amounts & Concentrations

DNA Template

Amount/Concentration

Plasmid for Single-Stranded Sequencing

2 µg of plasmid-DNA for a 1 kb insert and another 1 µg for each additional kb

Plasmid for Double-Stranded Sequencing

4 µg of plasmid-DNA for a 1 kb insert and another 2 µg for each additional kb



Chromatogram Evaluation >>to the top

 

It is always advisable to check the quality of the chromatogram by eye. Please use one of the Software tools for visualization in our Software and Links area.

 

 



1 In order to yield good sequencing results, please adjust your DNA plasmid solution within the requested concentration range. Please consider that the optimal DNA concentration is 80 ng/µl.
2 Direct primer synthesis for sequencing possible.

 

 

 


 

 

 

 

 

 

 

 

 

 

 

 

 

 




Questions?
Write an e-mail or call us at +41-71-722 83 33

to the top