Example 1: 5' truncated oligos after cloning and sequencing
Example 2: Restriction enyzme does not cut my PCR
Example 3: Mutations in hairpin oligonucleotides
Example 4: Influence of secondary structure
Example 5: Effect of PAGE purification on multiple deletions
Example 1: 5' truncated oligos after cloning and sequencing
Customer: “I have done PCR with two desalted 30mer primers from your company. After cloning and sequencing one clone we observed that the first 6 bases at the 5’end of the forward primer are missing. The reverse primer was completely correct”
Microsynth’s research: A long oligonucleotide was synthesized and used as template for PCR with the above mentioned 30mer primers. The high-fidelity polymerase Pfu I was used. At the same time, a new PAGE-purified synthesis of the 30mer primer was made. The blunt-end PCR was cloned, 29 - 35 clones were sequenced and the missing bases of the forward primer were counted. The result was as following:
| Complained oligo (desalted) | New oligo (PAGE-purified) | ||
Number of missing bases at the 5' end | Number of clones | Percentage | Number of clones | Percentage |
0 | 16 | 46% | 23 | 79% |
1 | 6 | 17% | 4 | 14% |
2 | 3 | 9% | 0 | 0% |
3 | 2 | 6% | 2 | 7% |
4 | 0 | 0% | 0 | 0% |
5 | 0 | 0% | 0 | 0% |
6 | 1 | 3% | 0 | 0% |
7 | 4 | 11% | 0 | 0% |
8 | 1 | 3% | 0 | 0% |
9 | 1 | 3% | 0 | 0% |
10 | 1 | 3% | 0 | 0% |
Total | 35 | 100% | 29 | 100% |
Conclusions:
- The new synthesis and/or PAGE purification clearly improved the quality and showed less missing bases at the 5’end. However, the new oligo which was even PAGE-purified still showed some 5’ truncated clones. At Microsynth, we have observed that many times and we are convinced that additional effects like PCR (for example prefered priming from 5’ truncated oligos), secondary structures, cloning artefacts contribute to this phenomenon.
- The customer unfortunately cloned one of the rare 6-base truncated molecules. 46% of the clones are completely correct, therefore by sequencing 2 – 3 additional clones it is possible to find the correct clone. We made this observation frequently, therefore Microsynth strongly recommends to sequence 1-4 clones before repeating the time consuming process of oligoresynthesis, PCR, cloning and sequencing.
Both oligos were compared with Maldi-TOF mass-spectroscopy (data not shown). This analysis corresponded with the sequencing data. No significant n-6 peak was visible in the Maldi-TOF spectrum.
Example 2: Restriction enyzme does not cut my PCR
Customer: “I was unable to cut the PCR product with my restriction enzyme although I have designed the first 6 bases at the 5’end as the restriction site”.
Microsynth: “This is the same observation as above. We recommend to add 3-6 bases before the restriction site”.
Example 3: Mutations in hairpin oligonucleotides
Customer: “ We have cloned long (50-80mer) oligonucleotides and sequenced 3 clones. All of them showed a mutation at the same position. The oligonucleotide shows a strong hairpin and is used for siRNA technique”.
Microsynth’s research: A 79mer oligonucleotide containing a 7-base hairpin (underlined) was synthesized by two different producers on two completely different oligosynthesizers.
5’CAAGAAGCGATGTCCTTGTCATCGCTAGAGCTATCTCCTAGCTGGATCGATCGATAAGGGATCTAGCCGATCTTGAGAT3’
At the same time, this oligonucleotide was synthesized again, but 3 bases (bold) are changed so that the hairpin was dissolved
5’CAAGAAGCGATGTCCTTGTCAGTGTTAGAGCTATCTCCTAGCTGGATCGATCGATAAGGGATCTGGCCGATCTTGAGAA3’
At Microsynth, we have PCR-amplified all three oligopairs using a high-fidelity Polymerase. After cloning, several (53 – 81) clones were sequenced. The sequence was analyzed using an alignment programm.
| Oligonucleotide No. 1 (hairpin) from producer 1 | Oligonucleotide No. 2 (hairpin) from producer 2 | Oligonucleotide No. 3 (no hairpin) |
Position of mutation | Number and kind* of mutations | Number and kind* of mutations | Number and kind* of mutations |
1 - 21 | 0 | 0 | 0 |
22 | 1 x Del 1 x Sub | 0 | 0 |
23 | 4 x Del 12 x Ins | 0 | 0 |
24 | 12 x Ins 1 x Sub | 42 x Sub | 0 |
25 | 2 x Del 2 x Sub | 0 | 0 |
26 - 30 | 1 x Del 5 x Ins | 0 | 0 |
31 - 35 | 2 x Del | 4 x Sub | 0 |
36 - 40 | 0 | 1 x Del | 0 |
41 - 45 | 0 | 5 x Sub | 1 x Sub |
46 - 50 | 1 x Del | 2 x Sub | 3 x Del |
51 - 55 | 1 x Del | 5 x Sub | 0 |
56 - 79 | 1 x Del 1 x Sub | 3 x Sub | 1 x Del |
Total number of mutations | 47 | 62 | 5 |
Number of sequenced clones | 53 | 63 | 81 |
% of correct clones | 17% | 14% | 85% |
*Ins = Insertion, Sub = Substitution, Del = Deletion
The investigation clearly shows that hairpin oligos are susceptible to mutations. This oligonucleotide has most failures in the positions 23 and 24 and almost all problems could be eliminated with the oligonucleotide No. 3 which does not contain a 7-base hairpin (see the following figures). The percentage of correct clones increased from
17 (14)% to 85%!
The question arises whether the mutations are introduced during the oligonucleotide synthesis or PCR. The oligonucleotides No. 1 and 2 are made on two synthesizers which are based on a completely different fluidic delivery system. We assume that the two synthesizers either respond in a different way when synthesizing this difficult region at position 23-24 or that the synthesis chemistry of the two producers is different which might lead to a different and incomplete deprotection in the hairpin region after synthesis and a subsequent misinterpretation by the PCR polymerase during the elongation.
Example 4: Influence of secondary structure
Customer: “ We have used your 24mer oligonucleotide for PCR and after cloning, we have seen that an insertion occurred after a restriction site, 3 bases before the 3’end. Even when we sequenced several clones, the insertion was always at the same place. We reordered the same primer and again the same insertion at the same position. We finally decided to redesign the primer by adding 7 bases at the 3’end and by cutting the first 9 bases at the 5’end. After cloning and sequencing this primer, the sequence was correct.”
Microsynth: “A typical structural effect caused this problem. Similar effects have been observed on various hairpin-oligonucleotides.”
Example 5: Effect of PAGE purification on multiple deletions
Long, unpurified oligonucleotides not only show single-base deletions but multiple-base deletions as well. Multiple base deletions are stretches of 2-20 bases which lack within an oligo sequence. At Microsynth, during several years of cloning research we have seen that multiple-base deletions will be completely eliminated after a PAGE purification. With a PAGE purification, it is even possible to reduce multiple-deletions of an HPLC-purified, long oligonucleotide. This shows that for oligonucleotides >50mer, PAGE has by far the better separation power compared to HPLC.
Short description of the experiment: Two 81mer and 79mer oligonucleotides containing a 15 base – complementary sequence are annealed, PCR amplified with a high-fidelity polymerase, cloned, several clones sequenced and the mutations in this 145bp fragment are counted.
Oligonucleotide pair No. 1 and 2 are either HPLC-purified only or a fraction of it was further purified with PAGE.
Oligonucleotide pair No. 3 is either desalted only or a fraction of it was further purified with PAGE.
Source of oligonucleotides / purity | Number of sequenced clones | Number of clones with multiple-deletions (2 – 54 bases) |
Oligonucleotide pair No. 1 HPLC-purified | 58 | 7 |
Same as No. 1, but 2nd purification by PAGE | 68 | 0 |
Oligonucleotide pair No.2 HPLC-purified | 66 | 5 |
Same as No. 2, but 2nd purification by PAGE | 83 | 1 |
Oligonucleotide pair No.3 desalted | 81 | 3 |
Same as No. 3, but purification by PAGE | 68 | 0 |
Summary
The most frequent mutation pattern observed in our experiments shows sequence errors spread all over the oligonucleotide at a low background. Unfortunately neither MALDI-TOF nor PAGE is able to recognize this pattern. Therefore we decided to test our synthesizers periodically for their mutation rate and percentage of correct clones.
At Microsynth all complaints are registered in a database since 4 years in order to optimize our services for customers interested in a long-term relation with our company. Data analysis show that 0.06% (6 out of 10000) of oligonucleotides produced at Microsynth are complained due to mutations.
