Experimental Design
The following summarises Microsynth’s recommendations on how to set up an RNAi experiment for mammalian cell cultures.
Note that Microsynth can advise the inexperienced researcher upon request.
A good experimental design and set up is crucial for the successful conduct of an RNAi experiment.
Parallel to the design of a good siRNA, a control siRNA should be created. This negative control oligo can be a scrambled version of the target siRNA (and should not have any homologies with known sequences) or an unspecific control siRNA (available from Microsynth). Additionally, the use of a good positive control oligo is recommended. For this Microsynth recommends the use of an siRNA directed against lamin A/C, which are non-essential proteins in human cells. Lamin A/C siRNA is available from Microsynth.
Illustration of a positive control siRNA:
5' A ACUGGACUUCCAGAAGAACA 3' mRNA target sequence (AA+N19 (or NN+N19))
-------siRNA core (N19)------- 5' CUGGACUUCCAGAAGAACAdTdT 3' si lamin A/C sense 3' dTdTGACCUGAAGGUCUUCUUGU 5' si lamin A/C antisense
Note that many siRNA design programs indicate mRNA target sequences (AA+N19 or NN+N19)). The corresponding siRNA consists then of the N19 core sequence plus an overhang (e.g. N19+dTdT). This is what should be ordered with our online form for siRNA. |
Day 1 of the experiment:
Seed cells in 24-well plates to reach a density of about 50 % at day 2. This is dependent on the kind of cells used, the transfection reagent used at day two and can also be optimized.
Day 2 of the experiment:
Check the cells by microscope. Confluency and health should be verified. Transfect the cells using the CodeBreaker transfection kit (Promega) according to the manufacturer’s protocol (Microsynth’s recommendation). Here is a brief summary (per well):
Prepare mixture A by pipetting 50 µl Optimem (serum-free, no antibiotics) with 0.5-3 µl of siRNA (Stock: 20 µM).
Prepare mixture B by pipetting 75 µl Optimem (serum-free, no antibiotics) with 3 µl of CodeBreaker reagent.
Incubate A and B for 5 minutes at room temperature.
Carefully add A to B and mix by pipetting gently (Transfection-mix).
Incubate 15-20 minutes at room temperature (this time can be optimized).
Meanwhile, remove the cell media and replace with 400 µl DMEM (serum-free with no antibiotics, or other suitable media).
Add 125 µl Transfection-mix dropwise to cells.
Incubate cells for 24-72 hours at 37o at 5% CO2.
Day 3 and 4 of the experiment:
Check the cells for confluency and health by microscope. If required replace media.
Day 5 of the experiment:
Read-out. Choose a suitable assay to address the degree of knockdown.
Different possibilities are plausible: Immunofluorescence, Western Blot analysis, Northern Blot analysis, RT- PCR, functional assays...
The choice of assay is based on several factors. However, the amount reduction of protein (not mRNA) is crucial for a phenotype observation. Therefore, Microsynth recommends performing either an Immunofluorescence experiment with a specific antibody (to look at the single cell level, shown below) or a Western Blot Analysis looking at a pool of cells (in this case the transfection efficiency of day 2 becomes crucial and should be analysed with a suitable control).
Example of readout by immunofluorescence analysis. Note the included controls:
untransfected cells mock-transfected cells unrelated siRNA
si lamin A/C si lamin B1 si lamin A/C/B1
Immunofluorescence 48 hours after RNAi using a lamin A/C specific antibody. Transfection of an siRNA for lamin A/C specifically knocks down lamin A/C. Note the untransfected cell at the lower right of the panel.
Picture taken by Sam Hasan at the Institute of Biochemistry, ETH Zürich, Switzerland (courtesy of U. Kutay)
Literature for the interested reader:
Defining and Assaying RNAi in Mammalian Cells, Huppi et al., Molecular Cell, Vol 17
