How to Design a Functional siRNA

There are two possiblities:

Use Microsynth's free of charge online siRNA design tool

Our online tool lets you design your siRNAs quickly, reliably, and comfy. It incorporates published design criteria with in-house extensions.

Microsynth's free of charge siRNA design service - GUARANTEED

Benefit from our experience and let us design your siRNA free of charge*. Just send us your mRNA sequence (or its database accession number) by e-mail.

If you let us design and synthesize 3 siRNAs for your gene of interest, we guarantee* that at least one of them knocks down the mRNA level to at least 30% (70% knockdown efficiency).

* service is limited to 5 genes per customer per day. Conditions for the guarantee: Delivery efficiency > 90%, effective concentration 100 nM, at least 48 hours incubation, positive control included in the experiment. One-time free replacement of the 3 siRNAs provided you contact us and tell us about your experiment.

Looking for validated siRNAs? You may find them here:

http://sirecords.umn.edu/siRecords/index.php

General information

Finding the optimal design strategy of siRNA is an area of active research. Recently, several studies have underlined the importance of several factors for an effective siRNA. Including these (empirically derived) criteria into the design of a siRNA increases the chance of creating a specific and highly effective siRNA in terms of knockdown.

Important criteria include:

Reynolds-Criteria ¹

The GC-content of the siRNA should be 30% to 52%
At least 3 A/U bases at position 5-19 of the sense strand
Absence of internal repeats (Tm of secondary structure < 20^o)
An A base at position 19 of the sense strand
An A base at position 3 of the sense strand
A U base at position 10 of the sense strand
A base other than G or C at position 19 of the sense strand
A base other than G at position 13 of the sense strand

Note that not all these criteria have to be fulfilled, but generally the more the better. Our online design program sorts the output with a score number that reflects these criteria.

Thermodynamic-Criteria: Accessibility of the target mRNA ²

Secondary structure of the target RNA seems to be important for silencing. Good accessibility (low secondary structure) of the mRNA at the target site increases the chance of successful RNAi.

Design

Microsynth advices its customers to design their siRNAs using either our online design tool or our guaranteed design service. Both are free of charge.

1) Identify potential target sequence using a our online design tool:

Microsynth's free online siRNA design tool

2) Check for potential off target effects by sequence comparison with the database via BLASTn:

Can be done directly with our siRNA design tool.

Microsynth recommends that 3 mismatches with unrelated sequences are optimal in order to fully exclude off-target effects.

3) Check target mRNA secondary structure using the link below. The structure should be accessible at the targeted site.

http://rna.tbi.univie.ac.at/cgi-bin/RNAfold.cgi

4) Order siRNA at Microsynth

Note: Microsynth supports the inexperienced customer in the design of siRNAs.

Important Information

Note that many siRNA design programs indicate mRNA target sequences (AA+N19 or NN+N19)). The corresponding siRNA consists then of the N19 core sequence plus an overhang (e.g. N19+dTdT). This is what should be ordered with our online form for siRNA.

Illustration:

5' A ACUGGACUUCCAGAAGAACA 3' mRNA target sequence (AA+N19 (or NN+N19))

-------siRNA core (N19)-------

5' CUGGACUUCCAGAAGAACAdTdT 3' si lamin A/C sense

3' dTdTGACCUGAAGGUCUUCUUGU 5' si lamin A/C antisense

Suggested literature for the interested reader:

¹ Mechanistic Insights Aid Computational Short Interfering RNA Design, Boese et al., Methods in Enzymology, Vol 392

Rational siRNA design for RNA interference, Reynolds et al., Nature Biotechnology, Vol 22

²Local RNA Target Structure Influences siRNA Efficacy: A Systemic Global Analysis, Overhoff et al., JMB Vol 348